Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1300815
End position: 1300838
Length: 24

DNA sequence
>NC_022657, from 1300815 to 1300838 (24 bp); Actinoplanes friuliensis DSM 7358 GCGGTGGCGGTGGAGGTGGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1300813-1301772	Sequence	AFR_05915 - CdaR family transcriptional regulator (Protein is coded in complementary strand; from 1301772 to 1300813)