Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1199716
End position: 1199739
Length: 24

DNA sequence
>NC_022657, from 1199716 to 1199739 (24 bp); Actinoplanes friuliensis DSM 7358 AGCCAGAGCGAGGGCCAGAGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1199638-1199883	Sequence	AFR_05490 - hypothetical protein (Protein is coded in complementary strand; from 1199883 to 1199638)