Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1133569
End position: 1133595
Length: 27

DNA sequence
>NC_022657, from 1133569 to 1133595 (27 bp); Actinoplanes friuliensis DSM 7358 CCGGCCCGCCGGGCCCGCCCGACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1133421-1135265	Sequence	AFR_05205 - hypothetical protein (Protein is coded in complementary strand; from 1135265 to 1133421)