Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 916974
End position: 917003
Length: 30

DNA sequence
>NC_022653, from 916974 to 917003 (30 bp); Bacillus amyloliquefaciens CC178 GCTGCTGCTGCTGCTGATTCTGCTGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 916340-917008	Sequence	U471_09250 - hypothetical protein (Protein is coded in complementary strand; from 917008 to 916340)