Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 764457
End position: 764510
Length: 54

DNA sequence
>NC_022653, from 764457 to 764510 (54 bp); Bacillus amyloliquefaciens CC178 TTCACCGGAGCAACGGGGTGCACCGGAGCAACGGGGCTGACCGGAGCAACAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 764445-764711	Sequence	U471_07600 - hypothetical protein (Protein is coded in complementary strand; from 764711 to 764445)