Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 2773979
End position: 2774005
Length: 27

DNA sequence
>NC_022653, from 2773979 to 2774005 (27 bp); Bacillus amyloliquefaciens CC178 GTTTCGCCTGTTTCGCATATTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2773484-2775070	Sequence	U471_27550 - acsA1 (Protein is coded in complementary strand; from 2775070 to 2773484)