Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 2260794
End position: 2260817
Length: 24

DNA sequence
>NC_022653, from 2260794 to 2260817 (24 bp); Bacillus amyloliquefaciens CC178 TGTTTTTCTTTTTCTTTTCGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2260737-2260964	Sequence	U471_22490 - hypothetical protein (Protein is coded in complementary strand; from 2260964 to 2260737)