Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 2234820
End position: 2234843
Length: 24

DNA sequence
>NC_022653, from 2234820 to 2234843 (24 bp); Bacillus amyloliquefaciens CC178 CAAATGCACAAATACACAAAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2234769-2235260	Sequence	U471_22170 - hypothetical protein (Protein is coded in complementary strand; from 2235260 to 2234769)