Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 1816028
End position: 1816075
Length: 48

DNA sequence
>NC_022653, from 1816028 to 1816075 (48 bp); Bacillus amyloliquefaciens CC178 CCATATCCATACCCATACCCATACCCATATCCATACCCATATCCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1815895-1816080	Sequence	U471_18060 - hypothetical protein (Protein is coded in complementary strand; from 1816080 to 1815895)