Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 1301826
End position: 1301849
Length: 24

DNA sequence
>NC_022653, from 1301826 to 1301849 (24 bp); Bacillus amyloliquefaciens CC178 TTCTTTATCTTTTTCCTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1301317-1302102	Sequence	U471_13680 - flagellar motor protein MotB (Protein is coded in complementary strand; from 1302102 to 1301317)