Sequence retrieval

Genome: Bacillus amyloliquefaciens CC178
Start position: 1226237
End position: 1226260
Length: 24

DNA sequence
>NC_022653, from 1226237 to 1226260 (24 bp); Bacillus amyloliquefaciens CC178 TTATCTTTTTTTCTTTTTATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1225643-1226260	Sequence	U471_12790 - pit accessory protein (Protein is coded in complementary strand; from 1226260 to 1225643)