Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 886812
End position: 886883
Length: 72

DNA sequence
>NC_022604, from 886812 to 886883 (72 bp); Staphylococcus aureus subsp. aureus Z172 TAGTGGTTCAGATTCAGCGAGTGATTCAGATTCAGCAAGTGATTCAGACTCAGCGAGTGATTCAGATTCA GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 885050-887833	Sequence	SAZ172_0800 clfA Clumping factor ClfA, fibrinogen-binding protein