Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 132248
End position: 132319
Length: 72

DNA sequence
>NC_022604, from 132248 to 132319 (72 bp); Staphylococcus aureus subsp. aureus Z172 TTTTTGTTGTCTTCTTTACCAGGTTTGTTGCCGTCTTCTTTACCAGGCTTGTTGTTGTCTTCTTTGCCAG GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 131864-133144	Sequence	SAZ172_0122 spa Protein A, von Willebrand factor binding protein Spa (Protein is coded in complementary strand; from 133144 to 131864)