Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 637116
End position: 637169
Length: 54

DNA sequence
>NC_022604, from 637116 to 637169 (54 bp); Staphylococcus aureus subsp. aureus Z172 TCAGACTCGGATAGCGACTCAGACTCAGATAGCGACTCAGATTCGGATAGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 634852-637623	Sequence	SAZ172_0564 sdrC Adhesin of unknown specificity SdrC