Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2886938
End position: 2886991
Length: 54

DNA sequence
>NC_022604, from 2886938 to 2886991 (54 bp); Staphylococcus aureus subsp. aureus Z172 TCTGAATCGCTGTCTGAATCTGAATCGCTATCTGAATCCGAATCGCTGTCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2886425-2889244	Sequence	SAZ172_2749 clfB Clumping factor ClfB, fibrinogen binding protein (Protein is coded in complementary strand; from 2889244 to 2886425)