Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2587514
End position: 2587558
Length: 45

DNA sequence
>NC_022604, from 2587514 to 2587558 (45 bp); Staphylococcus aureus subsp. aureus Z172 TTATTATTCGCTTGGTTATTACTTGATTGGTTATTATTTGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2587193-2587822	Sequence	SAZ172_2472 - Hypothetical protein (Protein is coded in complementary strand; from 2587822 to 2587193)