Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1486173
End position: 1486217
Length: 45

DNA sequence
>NC_022604, from 1486173 to 1486217 (45 bp); Staphylococcus aureus subsp. aureus Z172 ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1486172-1487155	Sequence	SAZ172_1399 - Phosphate ABC transporter, periplasmic phosphate-binding protein PstS (Protein is coded in complementary strand; from 1487155 to 1486172)