Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2820138
End position: 2820167
Length: 30

DNA sequence
>NC_022604, from 2820138 to 2820167 (30 bp); Staphylococcus aureus subsp. aureus Z172 TTTTTTGACGTTTTTGGTCGTTTCTTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2820115-2821557	Sequence	SAZ172_2686 - Mobile element protein (Protein is coded in complementary strand; from 2821557 to 2820115)