Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2410682
End position: 2410711
Length: 30

DNA sequence
>NC_022604, from 2410682 to 2410711 (30 bp); Staphylococcus aureus subsp. aureus Z172 CATGTATCTTGATGCATCTTCAGGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2410074-2411111	Sequence	SAZ172_2281 - Macrolide-efflux protein (Protein is coded in complementary strand; from 2411111 to 2410074)