Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1619384
End position: 1619413
Length: 30

DNA sequence
>NC_022604, from 1619384 to 1619413 (30 bp); Staphylococcus aureus subsp. aureus Z172 TTTTGTTTCTGTATTTGTTTCTGTATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1618560-1619498	Sequence	SAZ172_1500 - Hypothetical protein (Protein is coded in complementary strand; from 1619498 to 1618560)