Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2139618
End position: 2139644
Length: 27

DNA sequence
>NC_022604, from 2139618 to 2139644 (27 bp); Staphylococcus aureus subsp. aureus Z172 TCATTATTATCTTTATTATCATTATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2139180-2140073	Sequence	SAZ172_1996 - Phage replication initiation protein (Protein is coded in complementary strand; from 2140073 to 2139180)