Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1194809
End position: 1194835
Length: 27

DNA sequence
>NC_022604, from 1194809 to 1194835 (27 bp); Staphylococcus aureus subsp. aureus Z172 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1193182-1195119	Sequence	SAZ172_1128 isdB Cell surface receptor IsdB for hemoglobin and hemoglobin-haptoglobin complexes (Protein is coded in complementary strand; from 1195119 to 1193182)