Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1068634
End position: 1068660
Length: 27

DNA sequence
>NC_022604, from 1068634 to 1068660 (27 bp); Staphylococcus aureus subsp. aureus Z172 TCAGGGTTGTTAGGGTTGTCAGGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1068583-1069593	Sequence	SAZ172_0989 sspA Glutamyl endopeptidase precursor, serine proteinase SspA (Protein is coded in complementary strand; from 1069593 to 1068583)