Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2981387
End position: 2981411
Length: 25

DNA sequence
>NC_022604, from 2981387 to 2981411 (25 bp); Staphylococcus aureus subsp. aureus Z172 TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2981382-2981867	Sequence	SAZ172_2830 - Mobile element protein (Protein is coded in complementary strand; from 2981867 to 2981382)