Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1942083
End position: 1942107
Length: 25

DNA sequence
>NC_022604, from 1942083 to 1942107 (25 bp); Staphylococcus aureus subsp. aureus Z172 TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1942078-1942563	Sequence	SAZ172_1803 - Mobile element protein (Protein is coded in complementary strand; from 1942563 to 1942078)