Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1809131
End position: 1809155
Length: 25

DNA sequence
>NC_022604, from 1809131 to 1809155 (25 bp); Staphylococcus aureus subsp. aureus Z172 TTCTTTTTTTATCTTTTCTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1808283-1809203	Sequence	SAZ172_1695 dnaI Helicase loader DnaI (Protein is coded in complementary strand; from 1809203 to 1808283)