Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 908600
End position: 908623
Length: 24

DNA sequence
>NC_022604, from 908600 to 908623 (24 bp); Staphylococcus aureus subsp. aureus Z172 AAAAGTATAAAAGTTTAAAAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 908249-909070	Sequence	SAZ172_0829 - Methionine ABC transporter substrate-binding protein