Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 487671
End position: 487694
Length: 24

DNA sequence
>NC_022604, from 487671 to 487694 (24 bp); Staphylococcus aureus subsp. aureus Z172 GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 486998-488209	Sequence	SAZ172_0439 hsdS1 Type I restriction-modification system, specificity subunit S 1