Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2940999
End position: 2941022
Length: 24

DNA sequence
>NC_022604, from 2940999 to 2941022 (24 bp); Staphylococcus aureus subsp. aureus Z172 TTCTTTATTTATTTATTTATTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2940157-2941041	Sequence	SAZ172_2789 icaC Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaC