Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2185833
End position: 2185856
Length: 24

DNA sequence
>NC_022604, from 2185833 to 2185856 (24 bp); Staphylococcus aureus subsp. aureus Z172 ATTAGTATGAGTAGTAGTAATAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2185777-2186379	Sequence	SAZ172_2054 - adenylate kinase-related kinase (Protein is coded in complementary strand; from 2186379 to 2185777)