Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 2168258
End position: 2168281
Length: 24

DNA sequence
>NC_022604, from 2168258 to 2168281 (24 bp); Staphylococcus aureus subsp. aureus Z172 TTTGGATTCGGATTTGGCTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2167547-2168806	Sequence	SAZ172_2032 - Membrane anchored protein (Protein is coded in complementary strand; from 2168806 to 2167547)