Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1439078
End position: 1439101
Length: 24

DNA sequence
>NC_022604, from 1439078 to 1439101 (24 bp); Staphylococcus aureus subsp. aureus Z172 CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1439017-1439379	Sequence	SAZ172_1360 mscL Large-conductance mechanosensitive channel (Protein is coded in complementary strand; from 1439379 to 1439017)