Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus Z172
Start position: 1075229
End position: 1075252
Length: 24

DNA sequence
>NC_022604, from 1075229 to 1075252 (24 bp); Staphylococcus aureus subsp. aureus Z172 TAGGTGTTGGTGTAGGCGTAGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1073260-1077030	Sequence	SAZ172_0993 atl Phage lysin, N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 1077030 to 1073260)