Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 96966
End position: 97001
Length: 36

DNA sequence
>NC_022576, from 96966 to 97001 (36 bp); Comamonadaceae bacterium CR AGAAGGCGAATCAGGAGGCGAATCAGCAGACGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 96478-97599	Sequence	Cenrod_0116 pheS phenylalanyl-tRNA synthetase subunit alpha (Protein is coded in complementary strand; from 97599 to 96478)