Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 907070
End position: 907096
Length: 27

DNA sequence
>NC_022576, from 907070 to 907096 (27 bp); Comamonadaceae bacterium CR TCGGCAGCATCGGCTGCATCGGCAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 906317-908422	Sequence	Cenrod_0848 - extracellular protein (Protein is coded in complementary strand; from 908422 to 906317)