Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 680879
End position: 680923
Length: 45

DNA sequence
>NC_022576, from 680879 to 680923 (45 bp); Comamonadaceae bacterium CR TTGGTTCCCGGTGCAATGGTTCCCGGTGCAATGGTTCCCTGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 678566-681049	Sequence	Cenrod_0637 ostA lipopolysaccharide assembly protein (Protein is coded in complementary strand; from 681049 to 678566)