Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 556655
End position: 556690
Length: 36

DNA sequence
>NC_022576, from 556655 to 556690 (36 bp); Comamonadaceae bacterium CR TGCCTCGCTCCATGCCTTGCTCTATGCCTTGCTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 556465-557472	Sequence	Cenrod_0525 - hypothetical protein (Protein is coded in complementary strand; from 557472 to 556465)