Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 311269
End position: 311304
Length: 36

DNA sequence
>NC_022576, from 311269 to 311304 (36 bp); Comamonadaceae bacterium CR TGGATTGGGAAATGGACTGGGAAGTGGACTGGGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 310805-311350	Sequence	Cenrod_0283 - methylated-DNA-[protein]-cysteine S-methyltransferase (Protein is coded in complementary strand; from 311350 to 310805)