Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2567715
End position: 2567741
Length: 27

DNA sequence
>NC_022576, from 2567715 to 2567741 (27 bp); Comamonadaceae bacterium CR GCGGCTGCTGGGGCTGCTGGGGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2567133-2568572	Sequence	Cenrod_2327 - FkbM-family methyltransferase (Protein is coded in complementary strand; from 2568572 to 2567133)