Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2538973
End position: 2538996
Length: 24

DNA sequence
>NC_022576, from 2538973 to 2538996 (24 bp); Comamonadaceae bacterium CR TGGCGGTGGCGGTGGTGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2537313-2539025	Sequence	Cenrod_2311 fliF flagellar M-ring protein FliF (Protein is coded in complementary strand; from 2539025 to 2537313)