Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2314968
End position: 2314991
Length: 24

DNA sequence
>NC_022576, from 2314968 to 2314991 (24 bp); Comamonadaceae bacterium CR GTGGCAGTGGCAGTGGCAGTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2314587-2315852	Sequence	Cenrod_2096 - aminomethyltransferase (Protein is coded in complementary strand; from 2315852 to 2314587)