Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2188442
End position: 2188489
Length: 48

DNA sequence
>NC_022576, from 2188442 to 2188489 (48 bp); Comamonadaceae bacterium CR TTCATGTATTTATGTATTTATGTATTTATGTATTTATGTATTTATGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2188242-2188442	Sequence	Cenrod_1996 - hypothetical protein (Protein is coded in complementary strand; from 2188442 to 2188242)