Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2165725
End position: 2165751
Length: 27

DNA sequence
>NC_022576, from 2165725 to 2165751 (27 bp); Comamonadaceae bacterium CR GGCAAAACCGGCAAAACAGGAAAAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2165420-2165824	Sequence	Cenrod_1973 - hypothetical protein (Protein is coded in complementary strand; from 2165824 to 2165420)