Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 2127513
End position: 2127568
Length: 56

DNA sequence
>NC_022576, from 2127513 to 2127568 (56 bp); Comamonadaceae bacterium CR CCTACTTTTTCATCTCTATTTTTTCATCCCTACTTTCTAATCCCTGCTTCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2127543-2128661	Sequence	Cenrod_1931 - response regulator-like protein (Protein is coded in complementary strand; from 2128661 to 2127543)