Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1931819
End position: 1931872
Length: 54

DNA sequence
>NC_022576, from 1931819 to 1931872 (54 bp); Comamonadaceae bacterium CR CGCCATGCGCGAGCAGGTTGCTATGCGCGAGCAAGTCGCCATACACGAGCAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1931239-1932174	Sequence	Cenrod_1761 atpG F-type proton-transporting ATPase subunit gamma