Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1742212
End position: 1742247
Length: 36

DNA sequence
>NC_022576, from 1742212 to 1742247 (36 bp); Comamonadaceae bacterium CR GCAAACGGCCATGAAGACGGCCATGGAAACGGCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1741279-1742226	Sequence	Cenrod_1588 - hypothetical protein
ORF. 1742126-1742578	Sequence	Cenrod_1589 - hypothetical protein (Protein is coded in complementary strand; from 1742578 to 1742126)