Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1686719
End position: 1686745
Length: 27

DNA sequence
>NC_022576, from 1686719 to 1686745 (27 bp); Comamonadaceae bacterium CR CCCGTATTCCCCGTATTCCCCGTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1686745-1687350	Sequence	Cenrod_1530 - chemotaxis protein CheC (Protein is coded in complementary strand; from 1687350 to 1686745)