Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1653841
End position: 1653864
Length: 24

DNA sequence
>NC_022576, from 1653841 to 1653864 (24 bp); Comamonadaceae bacterium CR CAGGAGCAGGGGCCGGAGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1653711-1653965	Sequence	Cenrod_1497 - hypothetical protein (Protein is coded in complementary strand; from 1653965 to 1653711)