Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1418548
End position: 1418577
Length: 30

DNA sequence
>NC_022576, from 1418548 to 1418577 (30 bp); Comamonadaceae bacterium CR GCGCTGGCTCGCGCTGCATCGCGCTGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1416322-1418946	Sequence	Cenrod_1290 - hypothetical protein (Protein is coded in complementary strand; from 1418946 to 1416322)