Sequence retrieval

Genome: Comamonadaceae bacterium CR
Start position: 1386404
End position: 1386430
Length: 27

DNA sequence
>NC_022576, from 1386404 to 1386430 (27 bp); Comamonadaceae bacterium CR GGAACGACGGGGACGACGGGGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1386368-1387393	Sequence	Cenrod_1267 - response regulator (Protein is coded in complementary strand; from 1387393 to 1386368)